Basic information from miRBase |
hairpin accession number: MI0015536 |
Located between position 5410620 and 5410672 on chromosome 7q strand - |
Overlapping with antisense strand of (intron 21). |
(Ensemble: ENSCINT00000015751) |
mature miRNAs for MI0015536: |
cin-miR-4006a-5p (MIMAT0016478): TGGAACATGTAAGTAAGGGC |
cin-miR-4006a-2-3p (MIMAT0016968): GTCGTTACCAACATGTTTTAC |
You can find this miRNA in ENTREZGENE: mir4006a-2 (accession: 100499024) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |