| Basic information from miRBase |
| hairpin accession number: MI0015531 |
| Located between position 5412601 and 5412650 on chromosome 7q strand - |
| Overlapping with antisense strand of (intron 21). |
| (Ensemble: ENSCINT00000015751) |
| mature miRNAs for MI0015531: |
| cin-miR-4006b-5p (MIMAT0016472): TGGAACATGTACGTAAGGGC |
| cin-miR-4006b-3p (MIMAT0016473): GCTATTACTTATATGTTGCA |
| You can find this miRNA in ENTREZGENE: mir4006b (accession: 100499097) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |