| Basic information from miRBase |
| hairpin accession number: MI0015513 |
| Located between position 5411381 and 5411431 on chromosome 7q strand - |
| Overlapping with antisense strand of (intron 21). |
| (Ensemble: ENSCINT00000015751) |
| mature miRNAs for MI0015513: |
| cin-miR-4001a-5p (MIMAT0016444): TGGAACTTATACGAACAGGC |
| cin-miR-4001a-2-3p (MIMAT0016974): GCCAATTCGTACAAGTTCAA |
| You can find this miRNA in ENTREZGENE: mir4001a-2 (accession: 100498878) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |