| Basic information from miRBase |
| hairpin accession number: MI0008853 |
| Located between position 82945279 and 82945387 on chromosome 9 strand - |
| Overlapping with sense strand of XM_001154403.1 (intron 15). |
| (Ensemble: ENSPTRT00000047299) |
| mature miRNAs for MI0008853: |
| ptr-miR-7 (MIMAT0002485): TGGAAGACTAGTGATTTTGTTGT |
| You can find this miRNA in ENTREZGENE: MIR7-1 (accession: 100316267) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |