| Basic information from miRBase |
| hairpin accession number: MI0008854 |
| Located between position 86323281 and 86323389 on chromosome 15 strand + |
| mature miRNAs for MI0008854: |
| ptr-miR-7 (MIMAT0002485): TGGAAGACTAGTGATTTTGTTGT |
| You can find this miRNA in ENTREZGENE: MIR7-2 (accession: 100316503) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |