| Basic information from miRBase |
| hairpin accession number: MI0015480 |
| Located between position 5268751 and 5268845 on chromosome 1q strand - |
| Overlapping with antisense strand of (intron 16). |
| (Ensemble: ENSCINT00000001357) |
| mature miRNAs for MI0015480: |
| cin-miR-1-5p (MIMAT0016392): ACCTACTTCTTTACATCTTC |
| cin-miR-1-3p (MIMAT0016393): TGGAATGTAAAGAAGTATGCGT |
| You can find this miRNA in ENTREZGENE: mir1 (accession: 100498861) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |