miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008892
Located between position 12993495 and 12993566 on chromosome LG5 strand -
mature miRNAs for MI0008892:
         tca-miR-1-5p (MIMAT0019092): CCGTGCTTCCTTACTTCCCATA
         tca-miR-1-3p (MIMAT0008352): TGGAATGTAAAGAAGTATGGAG
You can find this miRNA in ENTREZGENE: Mir1 (accession: 100314337)

References
[1]Singh J, Nagaraju J, Insect Mol Biol. 17:427-436(2008)., "In silico prediction and characterization of microRNAs from red flour beetle (Tribolium castaneum)"
[2]Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S, Genome Biol Evol. 2:686-696(2010)., "Functional shifts in insect microRNA evolution"