| Basic information from miRBase |
| hairpin accession number: MI0008118 |
| Located between position 69255536 and 69255594 on chromosome 7 strand + |
| Overlapping with antisense strand of XM_547643.2 (intron 14). |
| (Ensemble: ENSCAFT00000028973) |
| mature miRNAs for MI0008118: |
| cfa-miR-1 (MIMAT0006656): TGGAATGTAAAGAAGTATGTA |
| References |
| [1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |