| Basic information from miRBase |
| hairpin accession number: MI0012746 |
| Located between position 39912211 and 39912288 on chromosome 8 strand + |
| Overlapping with antisense strand of LOC100060229 (intron 11). |
| (Ensemble: ENSECAT00000025536) |
| mature miRNAs for MI0012746: |
| eca-miR-1 (MIMAT0012994): TGGAATGTAAAGAAGTATGTAT |
| You can find this miRNA in ENTREZGENE: MIR1 (accession: 100314828) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |