| Basic information from miRBase |
| hairpin accession number: MI0008412 |
| Located between position 60347499 and 60347568 on chromosome 20 strand + |
| Overlapping with sense strand of (intron 4). |
| (Ensemble: ENSPTRT00000025575) |
| mature miRNAs for MI0008412: |
| ptr-miR-1 (MIMAT0007946): TGGAATGTAAAGAAGTATGTAT |
| You can find this miRNA in ENTREZGENE: MIR1-1 (accession: 100316308) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |