miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0003489

Located between position 2191671 and 2191757 on chromosome 18 strand -

Overlapping with antisense strand of Mib1 (intron 12).

(Ensemble: ENSRNOT00000018025) (RGD: RGD)

mature miRNAs for MI0003489:

rno-miR-1* (MIMAT0003162): GCACATACTTCTTTATGTACCC

rno-miR-1 (MIMAT0003125): TGGAATGTAAAGAAGTGTGTAT

You can find this miRNA in ENTREZGENE: Mir1 (accession: 100314077)

References

[1]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"

[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"

[3]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"