miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008576
Located between position 53323170 and 53323254 on chromosome 6 strand +
mature miRNAs for MI0008576:
         ptr-miR-206 (MIMAT0008066): TGGAATGTAAGGAAGTGTGTGG
You can find this miRNA in ENTREZGENE: MIR206 (accession: 100316451)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"