| Basic information from miRBase |
| hairpin accession number: MI0015282 |
| Located between position 9 and 93 on chromosome emb|CABF01001061.1| strand + |
| mature miRNAs for MI0015282: |
| sja-miR-1 (MIMAT0016244): TGGAATGTGGCGAAGTATGGTC |
| References |
| [1]Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W, PLoS Negl Trop Dis. 4:e596(2010)., "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" |