Basic information from miRBase |
hairpin accession number: MI0007173 |
mature miRNAs for MI0007173: |
cin-miR-184 (MIMAT0006108): TGGACGGAGAACTGATAAGGGC |
You can find this miRNA in ENTREZGENE: mir184 (accession: 100187689) |
References |
[1]Fu X, Adamski M, Thompson EM, Mol Biol Evol. 25:1067-1080(2008)., "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" ![]() |
[2]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |
more data |
Data from CoGemiR |