| Basic information from miRBase |
| hairpin accession number: MI0002026 |
| Located between position 25989792 and 25989878 on chromosome 18 strand - |
| mature miRNAs for MI0002026: |
| dre-miR-184 (MIMAT0001853): TGGACGGAGAACTGATAAGGGC |
| You can find this miRNA in ENTREZGENE: mir184 (accession: 100033681) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |