Basic information from miRBase |
hairpin accession number: MI0008045 |
Located between position 28601513 and 28601569 on chromosome 21 strand + |
Overlapping with sense strand of XM_846858.1 (intron 3). |
(Ensemble: ENSCAFT00000009200) |
mature miRNAs for MI0008045: |
cfa-miR-139 (MIMAT0006645): TGGAGACGCGGCCCTGTTGGAA |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" ![]() |