| Basic information from miRBase |
| hairpin accession number: MI0008561 |
| Located between position 18507107 and 18507187 on chromosome 22 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSPTRT00000048420) |
| mature miRNAs for MI0008561: |
| ptr-miR-185 (MIMAT0008053): TGGAGAGAAAGGCAGTTCCTGA |
| You can find this miRNA in ENTREZGENE: MIR185 (accession: 100316111) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |