| Basic information from miRBase |
| hairpin accession number: MI0008489 |
| Located between position 32546134 and 32546277 on chromosome 20 strand - |
| mature miRNAs for MI0008489: |
| ptr-miR-1289 (MIMAT0008007): TGGAGTCCAGGAATCTGCATTTT |
| You can find this miRNA in ENTREZGENE: MIR1289-1 (accession: 100316437) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |