| Basic information from miRBase |
| hairpin accession number: MI0008490 |
| Located between position 135061248 and 135061357 on chromosome 5 strand - |
| Overlapping with sense strand of XM_001165772.1 (intron 4). |
| (Ensemble: ENSPTRT00000031904) |
| mature miRNAs for MI0008490: |
| ptr-miR-1289 (MIMAT0008007): TGGAGTCCAGGAATCTGCATTTT |
| You can find this miRNA in ENTREZGENE: MIR1289-2 (accession: 100316412) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |