| Basic information from miRBase |
| hairpin accession number: MI0007613 |
| Located between position 51716504 and 51716588 on chromosome 18 strand + |
| mature miRNAs for MI0007613: |
| mml-miR-122a (MIMAT0006180): TGGAGTGTGACAATGGTGTTTG |
| You can find this miRNA in ENTREZGENE: MIR122A (accession: 100315191) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |