| Basic information from miRBase |
| hairpin accession number: MI0008431 |
| Located between position 54917465 and 54917548 on chromosome 18 strand + |
| mature miRNAs for MI0008431: |
| ptr-miR-122 (MIMAT0007963): TGGAGTGTGACAATGGTGTTTG |
| You can find this miRNA in ENTREZGENE: MIR122 (accession: 100316050) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |