Basic information from miRBase |
hairpin accession number: MI0008431 |
Located between position 54917465 and 54917548 on chromosome 18 strand + |
mature miRNAs for MI0008431: |
ptr-miR-122 (MIMAT0007963): TGGAGTGTGACAATGGTGTTTG |
You can find this miRNA in ENTREZGENE: MIR122 (accession: 100316050) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |