Basic information from miRBase |
hairpin accession number: MI0011584 |
Located between position 5068570 and 5068684 on chromosome 2L strand + |
Overlapping with sense strand of qtc-RB (intron 4). |
(Ensemble: FBtr0079013) (FlyBase: FlyBase) |
mature miRNAs for MI0011584: |
dme-miR-2495-5p (MIMAT0012204): TGGCACTTCAATTGGGCTGACT |
dme-miR-2495-3p (MIMAT0012205): CGGCACCTAATTGAAATGCCCGCC |
References |
[1]Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC, Nat Genet. 42:6-9(2010)., "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" |