| Basic information from miRBase |
| hairpin accession number: MI0015545 |
| Located between position 2149015 and 2149074 on chromosome 10q strand - |
| mature miRNAs for MI0015545: |
| cin-miR-4008a-5p (MIMAT0016495): TGGCAGTATGCGCAAGTTAG |
| cin-miR-4008a-3p (MIMAT0016496): AGGGTTTATCCTGTCTGCCA |
| You can find this miRNA in ENTREZGENE: mir4008a (accession: 100498894) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |