| Basic information from miRBase |
| hairpin accession number: MI0015547 |
| Located between position 2148809 and 2148870 on chromosome 10q strand - |
| mature miRNAs for MI0015547: |
| cin-miR-4008c-5p (MIMAT0016499): TGGCAGTGATCGCAAGTTAG |
| cin-miR-4008c-3p (MIMAT0016500): AGGGGCTAAATTGCCTGCCA |
| You can find this miRNA in ENTREZGENE: mir4008c (accession: 100498895) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |