| Basic information from miRBase |
| hairpin accession number: MI0012851 |
| Located between position 17151965 and 17152024 on chromosome 21 strand + |
| Overlapping with sense strand of CDC20B (intron 2). |
| (Ensemble: ENSECAT00000017780) |
| mature miRNAs for MI0012851: |
| eca-miR-449a (MIMAT0013102): TGGCAGTGTATTGTTAGCTGGT |
| You can find this miRNA in ENTREZGENE: MIR449A (accession: 100315020) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |