Basic information from miRBase |
hairpin accession number: MI0000268 |
Located between position 9211727 and 9211836 on chromosome 1 strand - |
mature miRNAs for MI0000268: |
hsa-miR-34a (MIMAT0000255): TGGCAGTGTCTTAGCTGGTTGT |
hsa-miR-34a* (MIMAT0004557): CAATCAGCAAGTATACTGCCCT |
You can find this miRNA in EMBL: HSA550399 (accession: AJ550399) |
References | ||||||||||||||
[1]Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP, Science. 299:1540(2003)., "Vertebrate microRNA genes" | ||||||||||||||
[2]Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G, RNA. 9:180-186(2003)., "Numerous microRNPs in neuronal cells containing novel microRNAs" | ||||||||||||||
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
[4]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" |
PROMOTER INFORMATION | ||||||||||||||
112 | chr1, 9164884-9165084, - | promoter sequence | Marson et al. | |||||||||||
525 | chr1, 9134314-9139423, - | promoter sequence | UCSC | |||||||||||
1248 | chr1, 9163734-9168733, - | promoter sequence | Corcoran et al. |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |
Pathway information from dPORE-miRNA |
Polymorphism data from Patrocles |