miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013826
Located between position 5249928 and 5249999 on chromosome 21 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018554)
mature miRNAs for MI0013826:
         tgu-miR-34a (MIMAT0014598): TGGCAGTGTCTTAGCTGGTTGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"