miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008492
Located between position 41094267 and 41094352 on chromosome 12 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSPTRT00000069834)
mature miRNAs for MI0008492:
         ptr-miR-1291 (MIMAT0008009): TGGCCCTGACTGAAGACCAGCAGT
You can find this miRNA in ENTREZGENE: MIR1291 (accession: 100316081)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"