Basic information from miRBase |
hairpin accession number: MI0008492 |
Located between position 41094267 and 41094352 on chromosome 12 strand + |
Overlapping with sense strand of (exon 1). |
(Ensemble: ENSPTRT00000069834) |
mature miRNAs for MI0008492: |
ptr-miR-1291 (MIMAT0008009): TGGCCCTGACTGAAGACCAGCAGT |
You can find this miRNA in ENTREZGENE: MIR1291 (accession: 100316081) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |