| Basic information from miRBase |
| hairpin accession number: MI0008588 |
| Located between position 94276078 and 94276144 on chromosome 9 strand + |
| Overlapping with sense strand of (intron 15). |
| (Ensemble: ENSPTRT00000039097) |
| mature miRNAs for MI0008588: |
| ptr-miR-24 (MIMAT0002751): TGGCTCAGTTCAGCAGGAACAG |
| You can find this miRNA in ENTREZGENE: MIR24-1 (accession: 100316125) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |