| Basic information from miRBase |
| hairpin accession number: MI0009948 |
| Located between position 151793265 and 151793353 on chromosome 2 strand - |
| mature miRNAs for MI0009948: |
| mmu-miR-1953 (MIMAT0009424): TGGGAAAGTTCTCAGGCTTCTG |
| You can find this miRNA in MGI: Mir1953 (accession: 3837034) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |