Basic information from miRBase |
hairpin accession number: MI0008495 |
Located between position 2553656 and 2553720 on chromosome 20 strand + |
Overlapping with sense strand of (intron 1). |
(Ensemble: ENSPTRT00000059328) |
mature miRNAs for MI0008495: |
ptr-miR-1292 (MIMAT0008011): TGGGAACGGGTTCCGGCAGACGCTG |
You can find this miRNA in ENTREZGENE: MIR1292 (accession: 100316438) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |