miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008495
Located between position 2553656 and 2553720 on chromosome 20 strand +
Overlapping with sense strand of (intron 1).
(Ensemble: ENSPTRT00000059328)
mature miRNAs for MI0008495:
         ptr-miR-1292 (MIMAT0008011): TGGGAACGGGTTCCGGCAGACGCTG
You can find this miRNA in ENTREZGENE: MIR1292 (accession: 100316438)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"