| Basic information from miRBase |
| hairpin accession number: MI0009960 |
| Located between position 29868655 and 29868713 on chromosome 7 strand - |
| Overlapping with sense strand of Ryr1-201 (intron 34). |
| (Ensemble: ENSMUST00000032813) |
| mature miRNAs for MI0009960: |
| mmu-miR-1963 (MIMAT0009436): TGGGACGAGATCATGAGGCCTTC |
| You can find this miRNA in MGI: Mir1963 (accession: 3837208) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |