| Basic information from miRBase |
| hairpin accession number: MI0014705 |
| Located between position 98487444 and 98487507 on chromosome 8 strand + |
| mature miRNAs for MI0014705: |
| mmu-miR-1186b (MIMAT0015644): TGGGATTAAAGGCATGCACCAC |
| You can find this miRNA in ENTREZGENE: Mir1186b (accession: 100499527) |
| References |
| [1]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" |