| Basic information from miRBase |
| hairpin accession number: MI0017772 |
| Located between position 9726759 and 9726880 on chromosome 3L strand - |
| Overlapping with sense strand of CG6749-RA (exon 1). |
| (Ensemble: FBtr0076410) (FlyBase: FlyBase) |
| mature miRNAs for MI0017772: |
| dme-miR-4986-5p (MIMAT0020223): TGGGATTCCCCATTCTGCATGGC |
| dme-miR-4986-3p (MIMAT0020224): CCATCGGATGGCGGAACTTCC |
| References |
| [1]Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC, Genome Res. 21:203-215(2011)., "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" |