| Basic information from miRBase |
| hairpin accession number: MI0018016 |
| Located between position 60971730 and 60971817 on chromosome 18 strand + |
| Overlapping with sense strand of Cd74-203 (exon 9). |
| (Ensemble: ENSMUST00000167610) |
| mature miRNAs for MI0018016: |
| mmu-miR-5107 (MIMAT0020615): TGGGCAGAGGAGGCAGGGACA |
| References |
| [1]Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S, Blood. [Epub prior to print](2011)., "Ordered progression of stage specific miRNA profiles in the mouse B2 B cell lineage" |