Basic information from miRBase |
hairpin accession number: MI0008090 |
Located between position 17976696 and 17976756 on chromosome 38 strand - |
Overlapping with sense strand of (exon 1). |
(Ensemble: ENSCAFT00000033548) |
mature miRNAs for MI0008090: |
cfa-miR-664 (MIMAT0006680): TGGGCTAGGAAAAATGATTGGA |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" ![]() |