| Basic information from miRBase |
| hairpin accession number: MI0017294 |
| Located between position 144815253 and 144815323 on chromosome 8 strand - |
| Overlapping with sense strand of FAM83H-001 (intron 1). |
| (Ensemble: OTTHUMT00000257632) |
| mature miRNAs for MI0017294: |
| hsa-miR-4664-5p (MIMAT0019737): TGGGGTGCCCACTCCGCAAGTT |
| hsa-miR-4664-3p (MIMAT0019738): CTTCCGGTCTGTGAGCCCCGTC |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |