| Basic information from miRBase |
| hairpin accession number: MI0008496 |
| Located between position 39455503 and 39455572 on chromosome 12 strand + |
| Overlapping with sense strand of XM_509057.2 (intron 2). |
| (Ensemble: ENSPTRT00000009109) |
| mature miRNAs for MI0008496: |
| ptr-miR-1293 (MIMAT0008012): TGGGTGGTCTGGAGATTTGTGC |
| You can find this miRNA in ENTREZGENE: MIR1293 (accession: 100316316) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |