miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008496
Located between position 39455503 and 39455572 on chromosome 12 strand +
Overlapping with sense strand of XM_509057.2 (intron 2).
(Ensemble: ENSPTRT00000009109)
mature miRNAs for MI0008496:
         ptr-miR-1293 (MIMAT0008012): TGGGTGGTCTGGAGATTTGTGC
You can find this miRNA in ENTREZGENE: MIR1293 (accession: 100316316)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"