miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000796
Located between position 110947270 and 110947335 on chromosome 12 strand +
mature miRNAs for MI0000796:
         mmu-miR-379 (MIMAT0000743): TGGTAGACTATGGAACGTAGG
         mmu-miR-379* (MIMAT0017080): TATGTAACATGGTCCACTAACT
You can find this miRNA in ENTREZGENE: Mirn379 (accession: 723858)

References
[1]Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M, Nature. 432:226-230(2004)., "A pancreatic islet-specific microRNA regulates insulin secretion"
[2]Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M, BMC Bioinformatics. 6:267(2005)., "Identification of clustered microRNAs using an ab initio prediction method"
[3]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
[4]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[6]Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H, J Virol. 84:10266-10275(2010)., "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
[7]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"


This microRNA is imprinted (based on ncRNAimprinted database)



more data
Expression data from PhenomiR