miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0006290
Located between position 110850032 and 110850151 on chromosome 12 strand +
Overlapping with sense strand of AC152063.3-201 (intron 2).
(Ensemble: ENSMUST00000165010)
mature miRNAs for MI0006290:
         mmu-miR-1188 (MIMAT0005843): TGGTGTGAGGTTGGGCCAGGA
         mmu-miR-1188* (MIMAT0017328): TCCGAGGCTCCCCACCACACCCTGC
You can find this miRNA in MGI: Mir1188 (accession: 3783362)

References
[1]Calabrese JM, Seila AC, Yeo GW, Sharp PA, Proc Natl Acad Sci U S A. 104:18097-18102(2007)., "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
[2]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[3]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"


This microRNA is imprinted (based on ncRNAimprinted database)