| Basic information from miRBase |
| hairpin accession number: MI0011933 |
| Located between position 5795147 and 5795375 on chromosome MtChr5 strand - |
| mature miRNAs for MI0011933: |
| mtr-miR2630n (MIMAT0013386): TGGTTTTGGTCCTTGGTATTT |
| References |
| [1]Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M, Plant Cell. 21:2780-2796(2009)., "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" |