| Basic information from miRBase |
| hairpin accession number: MI0005064 |
| Located between position 112437430 and 112437534 on chromosome 3 strand - |
| Overlapping with sense strand of NFYC_BOVIN (intron 5). |
| (Ensemble: ENSBTAT00000025381) |
| mature miRNAs for MI0005064: |
| bta-miR-30c (MIMAT0003850): TGTAAACATCCTACACTCTCAGC |
| You can find this miRNA in ENTREZGENE: MIR30C (accession: 791063) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |