miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008605
Located between position 41420145 and 41420232 on chromosome 1 strand +
Overlapping with sense strand of (intron 5).
(Ensemble: ENSPTRT00000045271)
mature miRNAs for MI0008605:
         ptr-miR-30c (MIMAT0002614): TGTAAACATCCTACACTCTCAGC
You can find this miRNA in ENTREZGENE: MIR30C-1 (accession: 100316134)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"