Basic information from miRBase |
hairpin accession number: MI0008605 |
Located between position 41420145 and 41420232 on chromosome 1 strand + |
Overlapping with sense strand of (intron 5). |
(Ensemble: ENSPTRT00000045271) |
mature miRNAs for MI0008605: |
ptr-miR-30c (MIMAT0002614): TGTAAACATCCTACACTCTCAGC |
You can find this miRNA in ENTREZGENE: MIR30C-1 (accession: 100316134) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |