miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005054
Located between position 9888794 and 9888860 on chromosome 9 strand -
mature miRNAs for MI0005054:
         bta-miR-30a-5p (MIMAT0003841): TGTAAACATCCTCGACTGGAAGCT
You can find this miRNA in ENTREZGENE: MIR30A (accession: 791053)

References
[1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
[2]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"