| Basic information from miRBase |
| hairpin accession number: MI0005054 |
| Located between position 9888794 and 9888860 on chromosome 9 strand - |
| mature miRNAs for MI0005054: |
| bta-miR-30a-5p (MIMAT0003841): TGTAAACATCCTCGACTGGAAGCT |
| You can find this miRNA in ENTREZGENE: MIR30A (accession: 791053) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |
| [2]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" |