| Basic information from miRBase |
| hairpin accession number: MI0012672 |
| Located between position 17435650 and 17435741 on chromosome 2 strand - |
| Overlapping with sense strand of LOC100053895 (intron 5). |
| (Ensemble: ENSECAT00000002155) |
| mature miRNAs for MI0012672: |
| eca-miR-30e (MIMAT0012916): TGTAAACATCCTTGACTGGAAG |
| You can find this miRNA in ENTREZGENE: MIR30E (accession: 100315112) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |