| Basic information from miRBase |
| hairpin accession number: MI0008606 |
| Located between position 41417217 and 41417307 on chromosome 1 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSPTRT00000045271) |
| mature miRNAs for MI0008606: |
| ptr-miR-30e (MIMAT0008092): TGTAAACATCCTTGACTGGAAG |
| You can find this miRNA in ENTREZGENE: MIR30E (accession: 100316135) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |