miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000867
Located between position 141365115 and 141365206 on chromosome 5 strand -
Overlapping with sense strand of D4ABS6_RAT (intron 4).
(Ensemble: ENSRNOT00000014457)
mature miRNAs for MI0000867:
         rno-miR-30e (MIMAT0000805): TGTAAACATCCTTGACTGGAAG
         rno-miR-30e* (MIMAT0004720): CTTTCAGTCGGATGTTTACAGC
You can find this miRNA in ENTREZGENE: Mir30e (accession: 100314153)

References
[1]Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H, Genes Dev. 20:1732-1743(2006)., "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes"
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"