| Basic information from miRBase |
| hairpin accession number: MI0005018 |
| Located between position 112440564 and 112440655 on chromosome 3 strand - |
| Overlapping with sense strand of NFYC_BOVIN (intron 5). |
| (Ensemble: ENSBTAT00000025381) |
| mature miRNAs for MI0005018: |
| bta-miR-30e-5p (MIMAT0003799): TGTAAACATCCTTGACTGGAAGCT |
| You can find this miRNA in ENTREZGENE: MIR30E (accession: 791017) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |