| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001202 |
| Located between position 19924487 and 19924561 on chromosome 3 strand + |
| Overlapping with antisense strand of SYIM_CHICK (intron 12). |
| (Ensemble: ENSGALT00000038573) |
| mature miRNAs for MI0001202: |
| gga-miR-194 (MIMAT0001133): TGTAACAGCAACTCCATGTGGA |
| You can find this miRNA in ENTREZGENE: (accession: 777806) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| more data |
| Data from CoGemiR |