| Basic information from miRBase |
| hairpin accession number: MI0003026 |
| Located between position 200725417 and 200725501 on chromosome 1 strand - |
| Overlapping with antisense strand of XM_514209.2 (intron 12). |
| (Ensemble: ENSPTRT00000003633) |
| mature miRNAs for MI0003026: |
| ptr-miR-194 (MIMAT0002729): TGTAACAGCAACTCCATGTGGA |
| You can find this miRNA in EMBL: AY866320 (accession: AY866320) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |